Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10086E8
Clone ID IST10086E8
Vector VICTR75
Project tigm

Sequence tag IST10086E8HMF3
Sequence
CTATATACTCAACTACACAAAGCCCAATGGCCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10086E8BBR1
Sequence
TAGAATATACCAGTGGGCAATAAATCTCCTGCAGGGGTGGTATTCTTAGAAATGAGGTAGTTCACCACTTTGGTCTGACT
TTGTACTTGAGTCTTAAAATGCCCCAGCTAAGATAGATATGGCAGTATACACCTAGATTCCCAACTGCTCTGGAACTGTT
TAAAATCTGTCTTGGAAAAACAGCAAGATCCTATCTCACTTTTTTTTTCCTGTTTGCCTCTTGTTAGTGAAAGTATACTG
TCCCGGCTAGCTGTCTTTATGTTGTGTATAAAAGTTTATGTTGTATTTGTATAAAAATTTAACTGCCAGTACCTAAAATT
TTGGTTTTTGGAAAAAAAAAAATCCTAAACAAGAAAGTTAATTTAGGGGTGGTTAAAATCATTGTGTGCTTTTGCAAAGG
ACCTAGGTTTGAGTCCCATACTCATAAGGTGGCTTCTAATAGTCTATAACTTACGTCCCAGGGTTCCAACAGCCTCTTCT
GGCCTCTGCAAGTAGTGCACAGACAAGCAGGGAAACCACCCATACACATAAAATAAGTTAGAAATTTAAGAAGGTTAGTT
TAGATCTGAGGTCTAAGACAACTCTCAGTGTGAAATAGGCACATCA
Sequence Type genomic DNA
Unitrap ID UNI20161

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 150732794..150733401 573
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059119 (Nap1l4) NM_008672 nucleosome assembly protein 1-like 4 Gene [Source:MGI Symbol;Acc:MGI:1316687]


Sequence tag IST10086E8BBF2
Sequence
ATCCACCCAGGGCCGGCCCAGGCTTCAAGGACACCCCAAGGTCAGGCTTCTCTCTTCGTGATGGTTGCGGGGGAGGAGCT
CGAGGAAAAGGATTAATTATTAGGAAAAACACAGGGCCATCAGAAGCACGGAAAAGGGGCTATGGAGCCCAGGTATAACG
AAACCTTTGCCTCCATACTGTTAGAAGGGGAGGGAAAGGATGTACGAGGCACGTGCACTTCTACGCTACAGCGGTTCCAG
ACTCAGAATCAAGGTCACAGATAAAGAAAGATAGTAAAGTGTTAATGGGCAACAGAGTACTGCAGCTGAGGAGTTTAGCC
TTCTCTCCTGGGGCTCCCCCGAAAGGAAACCAATTTCCTCCACCCCATCGCGTAAATCCTGAGACGGTGTAAGAGCCGAT
CGCCCCCGTCTCCCCATCGCTTCTTGAGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 133941827..133942254 422
 
EST/CDNA Est Name
  CN718534.1 - BG793473.1 - BU846857.1 - CK621319.1 - CD768628.1 - CK624599.1 - CA980388.1 - CA530036.1 - BQ936394.1 - CX733448.1 - DN176680.1 - CK780501.1 - CB598410.1 - CF906988.1 - CX238458.1 - CN676772.1 - CN703045.1 - BE372496.1 - CK331353.1 - BG176384

 
Come back to gene CN718534.1 - BG793473.1 - BU846857.1 - CK621319.1 - CD768628.1 - CK624599.1 - CA980388.1 - CA530036.1 - BQ936394.1 - CX733448.1 - DN176680.1 - CK780501.1 - CB598410.1 - CF906988.1 - CX238458.1 - CN676772.1 - CN703045.1 - BE372496.1 - CK331353.1 - BG176384


For any suggestions or comments, please send an email to unitrap@crg.es