Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12668H8
Clone ID IST12668H8
Vector VICTR76
Project tigm

Sequence tag IST12668H8HMF1
Sequence
ATTTTCCTTGGCTGTTGTGAATTAAATCTCCCAATAACCGCAGGAGACATCTTTGGGTACGGCCTGCTCACATCTCCGGC
ACCCACAGAAGTCGTTAAACGAATAACGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI2407

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123048469..123048581 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031822 (Gse1) NP_941073 genetic suppressor element 1 Gene [Source:MGI (curated);Acc:Gse1-002]


Sequence tag IST12668H8BBF1
Sequence
ATTTTCCTTGGCTGTTGTGAATTAAATCTCCCAATAACCGCAGGAGACATCTTTGGGTACGGCCTGCTCACATCTCCGGC
ACCCACAGAAGTCGTTAAACGAATAACGTTAACTTTCTCCAGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI2407

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123048469..123048595 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031822 (Gse1) NP_941073 genetic suppressor element 1 Gene [Source:MGI (curated);Acc:Gse1-002]

 
Come back to gene ENSMUSG00000031822


For any suggestions or comments, please send an email to unitrap@crg.es