Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15047B10
Clone ID IST15047B10
Vector VICTR78
Project tigm

Sequence tag IST15047B10HMR1
Sequence
GTTGTATAAGCNATATGTCCAGGCTCAAAGCTTAAAAACCATCTACATTTTTAGCCCCTCCCCCAAAACAGAGATGAGCC
AATTATGGGATTCTAAGCCCAACATCCACTCGCCCTAGACATTCCTGTACACTCAGCCTTGACAATTCAAAGTGTCTTTC
TCATTTACTAATTTAAGAACAAGATATAAAGATATTTAAAACGCAGCCTTCNTANNGTCCCACAGTATTGGGGAATACAG
GCTTTTAAACAAAAAATTCACTTGACAGAAAAAGTTGTATGAGGTAAAGCCCAAGAAAGCATANCTGCTGTATGTTC
Sequence Type genomic DNA
Unitrap ID UNI11930

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 59596416..59596731 306
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051705 (Senp8) NM_027838 SUMO/sentrin specific peptidase 8 Gene [Source:MGI Symbol;Acc:MGI:1918849]


Sequence tag IST15047B10BBF1
Sequence
AACCGGGTTACCAGGAAGAGGAAGGGTCCATAACTGAGGTGATCTGATTAGGATTGGAGATGGGAAGCAGAAGTGGTAGC
CGATGCANNNANGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000051705


For any suggestions or comments, please send an email to unitrap@crg.es