Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13652C9
Clone ID IST13652C9
Vector VICTR74
Project tigm

Sequence tag IST13652C9BBF1
Sequence
ACGGTAATTAGCAGTTAACAGGAGGAGGGGGCTAGAAGGTTCCACTTAGGTGTAAGCTGCACAGAANAAGCTATGCAGAT
CTA
Sequence Type genomic DNA
Unitrap ID UNI31678

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 32744062..32744143 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035656 (AC139244.4) Mucin Fragment [Source:UniProtKB/TrEMBL;Acc:Q9ERM1]

 
Come back to gene ENSMUSG00000035656


For any suggestions or comments, please send an email to unitrap@crg.es