Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12435C8
Clone ID IST12435C8
Vector VICTR76
Project tigm

Sequence tag IST12435C8BBF2
Sequence
GTGGTTAANAGTGCTTGCNCCTCTTTCANAGGACCANAGTTTCGGTCCTTGCACATGGCACATACATTTGTGTGACTCCN
GCTCCNNGAATCTGATGCCATCTAATGCCNNCNGNTGNCCCCCAGGTNAACACNCNCCCACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12435C8HMF1
Sequence
AGGCAGAGGCAGGAAGCTGAGAAGTTCAAAAAACACATTGGCAACATAGGGAGTATAATCCAGGCAGTCTTCAGGCAGAG
AGGCAGGAAGCTGAGGCGTTCAAAGACCACACTGCTGGCAACATANGGACACTGGGACATACAATGTTCTTTCTNAANAN
GGGGGTGGGGGGNNGN
Sequence Type genomic DNA
Unitrap ID UNI31749

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 119266823..119266994 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034813 (Grip1) NM_130891 glutamate receptor interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1921303]

 
Come back to gene ENSMUSG00000034813


For any suggestions or comments, please send an email to unitrap@crg.es