Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G077H02
Clone ID G077H02
Vector U3CEO
Project ggtc

Sequence tag G077H02
Sequence
GGGACTATGTATTCATTGAATTTTGTGTTGAAGACAGTAAAGATGTTAATGTAAACTTTGAAAAATCCAAACTCTCCTTT
GTAGTGTGTTGGGGAGGTAGCGATCATGTTAAGCAGTATGACATGAAACTGATCTTTTTCATTGTATTGATCCAAAGT
Sequence Type mRNA
Unitrap ID UNI3534

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127505760..127506340 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071072 (Ptges3) NM_019766 prostaglandin E synthase 3 (cytosolic) Gene [Source:MGI (curated);Acc:Ptges3-001]

 
Come back to gene ENSMUSG00000071072


For any suggestions or comments, please send an email to unitrap@crg.es