Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10029G4
Clone ID IST10029G4
Vector VICTR75
Project tigm

Sequence tag IST10029G4HMR1
Sequence
GGCAGGGGAANAGGGGGANTTGATCGTGGAGGCATGAGCAGAGGTGGGCGGGGAGGAGGACGCGGTGGACTGGGGTAAGA
GCAAAACCTTTTCTCCTTTTATCTAATTTTGTTTCATCCATAGGATTTTCAATGGAAAGAAGGGACTGAAAGACATAAGA
AATTTATCCCACATTTCCATGGACAATCTATTGCGGTCAAGCTATCTCCTAAAACATGGAAATGTCATTTAAGTGGCAGT
TTGCTTTTTTCCCTGCCAGTAACCATTGTTGGGCTGGGGTGAACAAAGAATGGCTTTGAAACTAGAGCTTTCAGTCCCCT
TCATGGTTTTCAGAGGTGAGAGCCTCTTTGGGTAATAGATTTGGGATGGAACACACACAACCCTTCTAATAACCCTAGCT
TTTAACTAATGTCCTGAACGGTTGTCTTGAAATACCTGGTGTATGTACTGCAGAAAAGGAATGCANCTGNTTTCCNATGT
TTGTACCCAGANTTGTTGATNNTGATGAANANTGACTGACCTCATGACCCTTAACNNTGGCCTNNNGCNNNCCNATGTGT
N
Sequence Type genomic DNA
Unitrap ID UNI12373

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4981769..4982329 519
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009079 (Ewsr1) NM_007968 Ewing sarcoma breakpoint region 1 Gene [Source:MGI (curated);Acc:Ewsr1-002]


Sequence tag IST10029G4BBF1
Sequence
CCTCCAGACTCCTGCCCATAAACACCCATGCTACTGGGGTGGTCCTGTCGGAATGAACCTGAGGAAAGAGTCACATCTGT
AAGCCACGGACCAGCATTCACACCAATGCCTGACACCCTTTCTCCTGGACTCATGGAGCTTTCAACATAAGCACTATGCT
CAAAGTATTTCTATCACAGGCTCTCTCTCTGTAAGAACTGTTGGCTTATCAAGGCCTTGTATGGCCAGGCTATAAAACTA
CTTCCAAAGGATTTTTCTTCTGGGAAAATATATTTGTAAGTTTCTGTGCTTCAGATGTCTCCAAAAGCAGCTTCTTTGCA
CTCTCAACACCAAAAGCAGTGAGTGCCAAGTTACCTAGGGCTCTGGCGTACAAAGGGCGGAATTGTAACTAGTCATCCCA
GCAACAAATAAAACAACACACACACACACACACACACACACACACACACACACACACACT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4982379..4982837 459
 
EST/CDNA Est Name
  BI158169.1 - AA080237.1 - BG245010.1 - BU503329.1 - CA539745.1 - BI454878.1 - BQ886994.1 - BF138765.1 - BG914969.1 - BU513121.1 - BF168341.1 - BY083425.1 - AA681882.1 - BQ950646.1 - AU043224.1 - BU055026.1 - CB056946.1 - CX243047.1 - BG964555.1 - CA568180

 
Come back to gene BI158169.1 - AA080237.1 - BG245010.1 - BU503329.1 - CA539745.1 - BI454878.1 - BQ886994.1 - BF138765.1 - BG914969.1 - BU513121.1 - BF168341.1 - BY083425.1 - AA681882.1 - BQ950646.1 - AU043224.1 - BU055026.1 - CB056946.1 - CX243047.1 - BG964555.1 - CA568180


For any suggestions or comments, please send an email to unitrap@crg.es