Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13241B11
Clone ID IST13241B11
Vector VICTR74
Project tigm

Sequence tag IST13241B11HMR1
Sequence
GAATGATAAAATTTGTTGATTGTAGACATTAGAAAACAACCCCACATGGTAAAGTTGTGTCATAAGCACAGAGCCTGGTA
TCCTGGCCGATGGTATGGTGGCCCTCTGGAGGGGCANANAGTTTGCAGCTGGCTGGGTGGGCAGGGTTGGCCCGAGGGCC
TGACTGAGTGGAGCCACGGTGGGTGTCAGGTTACAGCAGGCAGAGTGAGCGCGGGGACTGCCTGATCTGGANAGTGGCTT
TGTAATTACTGTGCTGATTTGTTAGGGAGGCTTTGTCTTACTTACCAATTAGCATGGATGTTACTGCAGAGACCTCTGAA
ACCCTGGGTAGGCTTTAGTTTAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI31752

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20539843..20540188 340
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049800 (Sertad2) NM_001038625 SERTA domain containing 2 Gene [Source:MGI (curated);Acc:Sertad2-001]


Sequence tag IST13241B11BBF1
Sequence
ATTCCTCTTAGGATTTTCACTATCAGCTAAATTGGATACAATTTCTAACGCTGGCTTATCAAACATAATCGTTTNNNNTG
AAAACAAATGGAATTTTAACNGGCNANAACNNNTTNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000049800


For any suggestions or comments, please send an email to unitrap@crg.es