Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13943B8
Clone ID IST13943B8
Vector VICTR74
Project tigm

Sequence tag IST13943B8HMF1
Sequence
GAGGTACGTTGTGAAACACGGTGACATGACTAATAGTTTGTAAAGACTAAGAGAGTAGGCAGTAAGTGTATTCACTACAA
AACTGTTATGAATTTAGTCATTCCAGAGCACACATAGAATCCAAAATATCATACTGTACTAATACCAAAACAAAACAAAC
ACACATACACACAAACAACAACAACAACAAAAACCCTAACACTAACCTCTGAAGGTTCCTGTCTATAACATCTTAAGAGG
TCGTGACTGTAAACAAGTCAAGGGTCACTGAAACGATACTATGAATACTAAGTGGAAAGGGAAGAAACAATGAGGGGACG
CAATGGTGGAGGTATGAATCTGCACATTCCTTCTTCATGTAGTGACAATTACATATTCTAAAACTTCAACCTCATTTCTC
AAACATTAAGAGCAAACTCGCAGCCNGGCGTGGTGGCGCACGCCTTTAATCCCAGCACTTGGGANGCAGANGCN
Sequence Type genomic DNA
Unitrap ID UNI31160

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28590566..28591038 467
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074243 (AC164532.4-202)  


Sequence tag IST13943B8BBF1
Sequence
GAGGTACGTTGTGAAACACGGTGACATGACTAATAGTTTGTAAAGACTAAGAGAGTAGGCAGTAAGTGTATTCACTACAA
AACTGTTATGAATTTAGTCNTTCCAGAGCACACATAGAATCCAAAATATCATACTGNNNTAATACCAAAACAAAACAAAC
ACACATACACACAAACAACAACAACAACAAAAACCCTAACACTAACCTCTGANGGTTCNNGNNNATAACATCTTAAGAGG
TNNNGANNGTNAACAAGTCAAGGGTCACTGAAACGATACTATGAATACTAAGTGGAAAGGGAAGAAACAATGAGGGGACG
CANTGGTGGANGTATGAATCTGCACATTCCTTCTTCATGTAGTGACAATTACATATTCTAAAACTTCAACCTCATTTCTC
AAACNTTAAGAGCNAACTCGCAGCCGGGCGTGGTGGCGCACGCCTTTAATCCCAGCACTTGGGAGGCAGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000074243


For any suggestions or comments, please send an email to unitrap@crg.es