Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14753G6
Clone ID IST14753G6
Vector VICTR76
Project tigm

Sequence tag IST14753G6HMR1
Sequence
CGCCCGGCTCAATCTGTCTTTTTAAAACAAACAAACAAACAAACAAACAAACAAACAGATGCAAGCTGGATACGGCAGTA
CTTTTCATCCCAGATAAGGCAGGAGAACTCTCTGTGAGTTTGAATTCTAGGCTAGCCAGGGCTACCCTGCCTCAAAAAAC
CAT
Sequence Type genomic DNA
Unitrap ID UNI31759

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95482785..95482947 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015850 (Adamtsl4) NM_144899 ADAMTS-like 4 Gene [Source:MGI (curated);Acc:Adamtsl4-001]

 
Come back to gene ENSMUSG00000015850


For any suggestions or comments, please send an email to unitrap@crg.es