Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13560H4
Clone ID IST13560H4
Vector VICTR74
Project tigm

Sequence tag IST13560H4BBF1
Sequence
AAAACCAAAATAAAATAAAATAAAATAAAATAAAATAA
Sequence Type genomic DNA
Unitrap ID UNI31595 UNI31596

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 65853889..65853926 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 119972481..119972518 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 86324307..86324344 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 44385935..44385972 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038725 (Pkhd1l1) NP_619615 polycystic kidney and hepatic disease 1-like 1 Gene [Source:MGI Symbol;Acc:MGI:2183153]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 34397323..34397360 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 26373050..26373087 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 33882716..33882753 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 48718070..48718107 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72367357..72367394 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 108807491..108807528 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034551 (Hdx) NM_001080549 highly divergent homeobox Gene [Source:MGI (curated);Acc:Hdx-002]

 
Come back to gene ENSMUSG00000034551


For any suggestions or comments, please send an email to unitrap@crg.es