Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13519B4
Clone ID IST13519B4
Vector VICTR74
Project tigm

Sequence tag IST13519B4HMF1
Sequence
GGATNACTTGACAGACTTTCTCAAGGCCCTCCAGTCCTATCTCCAGATAGAGCCTCTGCCCTGGCCCTTCTCCCAGGCGC
TCTCCTTGATCCTGGTGCAGGGGTCTCCCTCTCTTGTTCCTGGACTCCGCTTTGATTCCTTCCTCTGCCTTCTCTCTACA
AGAACAGGGTGACAGTCTGTCACTGTGTCTGGTGTGTTGGAAGGCAGGGACTACCCTTCTTCCCTCTGCATCCACAGCAA
ATCTCCTCAGNGGGATTTGAAAGTATGCCAAGAAAGAATTCTGCCTATCGTTACAGTTCGCTCCCATGTCAGACTACGAG
AGTCCGGCTTCGTCTTCAGCCGAGGAGTGAATACAGGGAGGAGCCNGTGAGTCCCCCAGGACCCACCAGCCNCAAGCCAC
GCATCAAACCGTCCCTCCTCCATCCCTCTGTCCCATTCTGCCTCGGCATTCCTCAGCCCCTGAACTTCCCTGAGGGNGCC
CTGACATCTACCN
Sequence Type genomic DNA
Unitrap ID UNI19739

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21573253..21573744 482
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032194 (Kank2) NM_145611 KN motif and ankyrin repeat domains 2 Gene [Source:MGI Symbol;Acc:MGI:2384568]

 
Come back to gene ENSMUSG00000032194


For any suggestions or comments, please send an email to unitrap@crg.es