Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14176H5
Clone ID IST14176H5
Vector VICTR74
Project tigm

Sequence tag IST14176H5BBF1
Sequence
TTCATCGCTGTCTTTGGGCTGAAAAAGAAACCCTTCTGATCACAATCCGGGTGTAGGGACCAAGGCTGGAAAAGTGATGA
AGCTTCCTCCCACTGCTGCAAGAAAAAGGCAGAGGCTTCAGTTTTCTCTCGCCCAAGTCCCTTGCTCCTCCCAACTGCGG
CTAAGCAGANGATGGCAGTGTTGGAATAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI23732

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 68886279..68886472 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020895 (Tmem107) NM_025838 transmembrane protein 107 Gene [Source:MGI (curated);Acc:Tmem107-002]


Sequence tag IST14176H5HMR1
Sequence
CAGGGAAGGATTTGACTGAGGCGGGAACGCGTTGCTAGCACGCTTTTTGTTGCTCATTCGGTGTCCAGGTGAGGCAGGCA
AGAGTCCCTAAACCCTCCCAGCCTGTGCGGGCCATCCCGTTGGCAATAGCGCGCTGAGTCTTANATCCACCATTGTGTGA
GGTACCGTTGAAGCTTAAGGTTCTTCCTGGANAACTTTGGCN
Sequence Type genomic DNA
Unitrap ID UNI4724

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 31702776..31702976 197
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006705 (Pknox1) NM_016670 Pbx/knotted 1 homeobox Gene [Source:MGI Symbol;Acc:MGI:1201409]

 
Come back to gene ENSMUSG00000006705


For any suggestions or comments, please send an email to unitrap@crg.es