Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14886E6
Clone ID IST14886E6
Vector VICTR76
Project tigm

Sequence tag IST14886E6HMF2
Sequence
CTTCCGACCATGGTTAGTAGGTTTGAGCCATTTTCTCTGCAGATGAGCCTGCCCAGTGTCCCTGTCTTCCTGGAGGTTTC
CGGCCAGTTTGATGTGGAGTTCCGGTTA
Sequence Type genomic DNA
Unitrap ID UNI31768

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4899242..4899348 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006464 (Bbs1) NM_001033128 Bardet-Biedl syndrome 1 (human) Gene [Source:MGI Symbol;Acc:MGI:1277215]


Sequence tag IST14886E6HMR1
Sequence
GGAAGAAACTGTTAATTCTTGACTAAAATCCTGATCTCTTTGTTCACTTCCTACTGGTCACAGCTTTAAGTCTACACCAT
TTGGCTAAACCCTGCCACCTCCAGCAAAGTATGANAGCGATGTAAGTAGAGATAAAGGCGTCTGAACAAGGGAGACCTTG
GAGCAGCATTGATAACAGTGAGAATCATTTCCGTGGACACCAAGTGGCCNGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4899344..4899552 207
NO GENE  

 
Come back to gene ENSMUSG00000006464


For any suggestions or comments, please send an email to unitrap@crg.es