Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14964E5
Clone ID IST14964E5
Vector VICTR76
Project tigm

Sequence tag IST14964E5HMR1
Sequence
TTTGATCNGTGGAAAACCNACAACAATTAAGAATCTTCATTCNGAAGATTCACTTCCACTTCCAACTAGGCCCATTAGTT
TTCTGATTCCACACAGTGATTCAAAACGTGTGCTCTATGTTTTGGGGTCACCTCTGTTTCAGGTCACCGCTACTCTGTTG
AGACTGTCTGTCANAAGCTCANANCANCTTTGGATCACTAGGTGCCCTGTCTGTGTTCAATTTGGGGAAATTGTGAACAA
TTC
Sequence Type genomic DNA
Unitrap ID UNI25563

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 42301995..42302236 228
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047261 (Gap43) NM_008083 growth associated protein 43 Gene [Source:MGI (curated);Acc:Gap43-001]


Sequence tag IST14964E5HMF1
Sequence
CAAATAGCTGAACCTATGCCTGCGCACACTGTTTCCATATTTTAAGTGTTAAAACTGACCCCGGGTGCTGTCACTGTAAT
ACTCAATGTAAAACTCAACCTAAGAATCTCTCTTACATAGTTTGTCTTCCACTCATCATATTAAGTTAAACTAGAATAAA
ACAGAGCAGTGTCTTTAGCATAGCATAGTATGCTTCTCCCCTGCTCTCACACAATTTTTTTGGGGGTATGTACATTGTTT
ATCAAGTTAAGAAGATATNCNTTGCTTTGGAATTTGGTTCANCCTANTCTTCNNANTGANANCNNAACTTCNNTCAANAA
ACCCTCANACNNNNNATATGCCCNNNTCAANGGAAGGNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14964E5BBF1
Sequence
CAAATAGCTGAACCTATGCCTGCGCACACTGTTTCCATATTTTAAGTGTTAAAACTGACCCCGGGTGCTGTCACTGTAAT
ACTCAATGTAAAACTCAACCTAAGAATCTCTCTTACATAGTTTGTCTTCCACTCATCATATTAAGTTAAACTAGAATAAA
ACAGAGCAGTGTCTTTAGCATAGCATAGTATGCTTCTCCCCTGCTCTCACACAATTTTTTTGGGGGTATGTACATTGTTT
ATCAAGTTAAGAAGATATACATTGCTTTGGAATTTGGTTCAACCTANTCTTCTAAGTGANAGCTGAACTTCANTCANAGA
AACCCTCNCACACCTCATANGCCCNNNTCNANGGAAGGTCTGTGTGCTCACNGNNNANGCNGCTTGACACCNCNANCTTC
CANGTCNACCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000047261


For any suggestions or comments, please send an email to unitrap@crg.es