Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14990F11
Clone ID IST14990F11
Vector VICTR78
Project tigm

Sequence tag IST14990F11HMR1
Sequence
NNGGAGGTATTTAGAATGGTTTGGAAAAGCATACAACGTATTTGTGAGTGTGTGTGCATTTCACATGCCAGCAGAGCAGA
AAGAATTTACAAGGCTTGGGGCTACTGAGCTTTCCTTAAGACACCATCACTCTCAGCTGTTGGGGTGATGTCAGAGATGC
CGGGAACACTGCTTAAGGCCCGAATTCCTGAGCTCTATTTGAATTGCAGAGAAGCTCTGTTTTGCATTGCAGAGCTTANA
GCAGGCCGGACCCATTCTGTGGGCTCTACCTTCAAAGACCTACGGAATTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI8919

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 49702129..49702419 289
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055653 (Gpc3) NM_016697 glypican 3 Gene [Source:MGI (curated);Acc:Gpc3-001]

 
Come back to gene ENSMUSG00000055653


For any suggestions or comments, please send an email to unitrap@crg.es