Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G075A01
Clone ID G075A01
Vector U3CEO
Project ggtc

Sequence tag G075A01
Sequence
CCTNNNCATCCATAGTGACCATGAGGGTGGTAATGTAAGTGCCCACACAAGCCATTTGGTGGGCAGCGCCCTTTCAGACC
CTTACCTGTCCTTTGCAGCAGCCATGAATGGGCTGGCGGGGCCTCTACATGGACTAGCAAATCAGAAGGTGCTTGTCTGG
CTGACGCACCCACAGAAGGGATTGGCCAAATACGTGTCAGATGAGAANNNNCGAGGCTACATCTGGAACACACTCAATTC
AGGACGGG
Sequence Type mRNA
Unitrap ID UNI11281

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127796224..127796592 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005683 (Cs) NM_026444 citrate synthase Gene [Source:MGI Symbol;Acc:MGI:88529]

 
Come back to gene ENSMUSG00000005683


For any suggestions or comments, please send an email to unitrap@crg.es