Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12780A5
Clone ID IST12780A5
Vector VICTR76
Project tigm

Sequence tag IST12780A5HMF1
Sequence
GGACCTCACATCTGCCCCGGCAAGTGCTCTAACACCAAGCCACAGTCTCCACCCCTAGGAATTTTTCAGCTATAGTTTTT
ATTTGTTTATTGTCTGTGATGTGTGTGGGTGCATGGGTAAAGGTGAGCGGACAATTTTGGGGAGTTGGCTCCCTTCTACC
ATCGTCCAATTGCCTCTAGAGCCATCTCCCCAGCCCCTGTCACTCTAATTTAGGCAGGATTACTATAGATGACTCACTCA
CAGCTGAGCGAGGTANTAAGCCATGATAACCTTCCCTTTTTATAGACCTTCTGTTTACCTGGGGTGAGTTGTTATCCTGG
TCGGTTTTTTGCTTGCTTTTTCTAAGTTCTTATATTCNTTTCAACTTCTTCCCTANTCTCCTGGANTTAGACCNTTGGCT
CCTTAAGCANTTTCACTTTCTAANAAAGCCTCANATAGGCTGCNNCCCANATGGCTGACCTCTGCGTCCNTCTGCCTGGA
Sequence Type genomic DNA
Unitrap ID UNI31775

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88250605..88251083 455
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028064 (Sema4a) NM_013658 sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A Gene [Source:MGI (curated);Acc:Sema4a-001]

 
Come back to gene ENSMUSG00000028064


For any suggestions or comments, please send an email to unitrap@crg.es