Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12062C9
Clone ID IST12062C9
Vector VICTR76
Project tigm

Sequence tag IST12062C9HMF1
Sequence
AGGCAAACTCACACTTTGCTGCCATACCTTTCTCTCTGGAACCCAGAAGAGCAGCCGTGTGAGAGAAAACACAACACAAA
CTCAGTTCAGAGACAATGGTGACTCAATCTCTGGGCGCAACAACTAAAACTTAATCCTGTAAACCTTACTAAAATCTGAT
TCCTCCAGTGGTGAATCCTTGCAGATCTGCCATGATACCAGGAAACTCTAGCAGCTATATCTTACCCACATGCCGTCCCC
ATTCCAAAAAAGCCTAACTCTCTCCTGCTCCCTCTCTTCCTCTGCCCAACCCCGAAGTCCCACCTACTTCTCCCAGTGGG
TGGCTCCTTTGTACATAAGGGGATTGGTTCACAAGAAGTCACCTGAGTACTTTTGACTCCTTCCTTGTCGGANNCCCCGC
CCAANANAGTGGAATTAGCATACNAACNGCACCAGGCCCATCCACAACAGATGTCNGAGANGGTGTTGGATCCCCTAGAG
CTGGAGTTTCAGANGTTGAGAGCCACCACGTGGGTGCTTTAACTGANCCCNNGGN
Sequence Type genomic DNA
Unitrap ID UNI20076

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96040149..96040680 504
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041440 (Gk5) NP_796326 glycerol kinase 5 (putative) Gene [Source:MGI (curated);Acc:Gk5-001]


Sequence tag IST12062C9BBF1
Sequence
AGGCAAACTCACACTTTGCTGCCATACCTTTCTCTCTGGAACCCAGAANAGCAGCCGTGTGAGAGAAAACACAACACAAA
CTCAGTTCAGAGACAATGGTGACTCAATCTCTGGGCGCAACAACTAAAACTTAATCCTGTAAACCTTACTAAAATCTGAT
TCCTCCAGTGGTGAATCCTTGCAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI20076

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96040149..96040337 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041440 (Gk5) NP_796326 glycerol kinase 5 (putative) Gene [Source:MGI (curated);Acc:Gk5-001]

 
Come back to gene ENSMUSG00000041440


For any suggestions or comments, please send an email to unitrap@crg.es