Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11648B11
Clone ID IST11648B11
Vector VICTR76
Project tigm

Sequence tag IST11648B11BBF1
Sequence
ATGGTGGCTCACAACCATCCTTAACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI170 UNI30484 UNI31776 UNI31777

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3678709..3678741 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 16628688..16628720 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56131003..56131035 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000011589 (Fsd1) NM_183178 fibronectin type 3 and SPRY domain-containing protein Gene [Source:MGI Symbol;Acc:MGI:1934858]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 23620442..23620474 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 69962680..69962712 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 29429423..29429455 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 54664956..54664988 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 95037798..95037830 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031129 (Slc9a9) NM_177909 solute carrier family 9 (sodium/hydrogen exchanger), member 9 Gene [Source:MGI Symbol;Acc:MGI:2679732]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 65722139..65722171 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 30180071..30180103 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 33910273..33910305 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 83629343..83629375 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 51801282..51801314 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115556364..115556396 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 130199878..130199910 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 31058651..31058683 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037625 (Cldn11) NM_008770 claudin 11 Gene [Source:MGI (curated);Acc:Cldn11-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 35888615..35888647 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59578982..59579014 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 63061312..63061344 33
NO GENE  


Sequence tag IST11648B11HMF2
Sequence
ATGGTGGCTCACAACNNTCCTTAACAAGATCTGACACCCTCTTCTGGANTGTCTGANNACAGCTNCAGTGTACTTACATA
TAATAATAAATAAATCTTTAAAAAAAAATGAATGTAAAAAAAAAAAGTGTGANTATGTAAGAGTGTGTGTGANAATGTGT
GCATTTGNGTGTGCAANTGTGTATTTAAATGTGTGAATGTGANAATGTATGTGTGTATGTGTGGCTATGTGTGCAATTGC
AAGTATGTATTCAAATGTGTGAGTGTGTGTGAATGTGTGCATACNTGTGTGCAAGTGTGTATTNAAATGTGTGAGTGTGA
GAATGTATCTGCTTATGTGTGGCTGTGTGTGCNAGTGTGTATTCNAATGTGTGAGTGTGTGTGAATGTGTGCATATGTGT
GTGCAAGTGTGTATTNAAATGTGTGTGTGTGCCANGCGTGNTGGCNCACNCCTTTAANCCNAGCACTTGGGAAGCANAGG
TNGGTGGATNTNTGAGTTCGAGGNCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000035168


For any suggestions or comments, please send an email to unitrap@crg.es