Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14317A9
Clone ID IST14317A9
Vector VICTR74
Project tigm

Sequence tag IST14317A9HMF1
Sequence
NACCCAGGTGGCTCGGGGCCTGGATCCTGATGGACTCCTGCTCGTGGACATGAAAATCAATGGCATGATCCCAGAGAGCC
TGGCTGACGGAGATCTGCGAGTACAGGTACTAGCTCTGGGCTGCTCCGCCAACCCACCCTAAGCAAACAGGCCCTCCTTC
CGTCCTCATACCCGANGAGGCAGTTGCCATGGGTCTCGAGAACATCACAGTCATGGTGCCACCCCCGACTGCCAGTTCTT
GATCAGAAGANACTTGCCCAGTCTTCACGCAGCACCCCAGCACCCTCCTGGCTTCTCTAAAGTGGGACCCTCCCTTTCCC
CCANGACTTCCAGGANCACTACGTGCAGACAGGGCCTGGCNNGCC
Sequence Type genomic DNA
Unitrap ID UNI31778

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 31308580..31308938 351
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055632 (Hmcn2) hemicentin 2 Gene [Source:MGI (curated);Acc:Hmcn2-001]


Sequence tag IST14317A9HMR1
Sequence
GTCATTGTGAGTANCTCCCCTGCAAGCCGTCCCCACCCATTCCGGAGTCNNCGCAGGGGCAGCCTGGGCTCGTCAGGCCC
TGCCCCCANCCGTCTGCAAGAANACCATGCTCACCTGTAGAAAATTCCATCTGTGACTCCTGCTGGAANCTGCCACCCGT
CAGANAGTANCCATTTAAGGCCTCTCCGCTCTCTCTANCCAGGGCCCAGTANATGGGGGCAATCGTGACCACCANCACCC
GCATTANAGGCCCTGGATGTANCANAACACAGAGGCCATGTTAGGACTGGAGTCTCGGGGCANCGATGCTGCTCACGATC
CCTCTGTGGCTCCCCCTTCTCTCANCCTTTCCCTCCCTGGCCGTGCTTGGCCTGGCNACTACACATGCCNGTTGTTNNNN
NNACCCCNNGANATNNCANAATATACTTTATGGAGCANCTANAAAAGCNNATATTATNAANANNTGCNTGGGATGTGATA
TTTANCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000055632


For any suggestions or comments, please send an email to unitrap@crg.es