Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CD0241
Clone ID CD0241
Vector pGT0lxfT2
Project sanger

Sequence tag CD0241
Sequence
CTATTGATGAGCCTTTCACACCGGCGAGTCTCGCCTTTTCTTCCCTCTGGCGGGTGACAATGCATCGGATAGTCAGTGTG
GTAGCCCCTCTGGGTTTTCGCCTGCAGGCACAACCCTTGGTCCAGAGTCGCCCACTCAGTTCTGTACAGGGTGGAGTCTG
CCTGTACAATACCGTGACAGTCATGTTGATTCACACCTGCACACACGCCGGCATTGCTCTCTCTTTGATGTGTCCCACAT
GCTACAGACCAAGATATTTGGCTGTGACCGAGTGAAGCTGCTGGAGAGTGTAGTGGTTGGAGACATTGCGGAACTAAGGC
CTAACCAGGGAACACTCTCTTTGTTTACCAACGAAGCTGGAGGCATCTTAGACGACTTGATTGTAAGCAATACTTCTGAG
GGGCACCTGTATGTAGTATCCAATGCTGGCTGCCGGGACAAGGACTTGGCTCTCATGCAG
Sequence Type mRNA
Unitrap ID UNI1483

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108199257..108201230 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032607 (Amt) NM_001013814 aminomethyltransferase Gene [Source:MGI Symbol;Acc:MGI:3646700]

 
Come back to gene ENSMUSG00000032607


For any suggestions or comments, please send an email to unitrap@crg.es