Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14678D2
Clone ID IST14678D2
Vector VICTR74
Project tigm

Sequence tag IST14678D2HMR1
Sequence
CCCCTAAACAGAACAATGGGCCTCTTCTTCAGGAGCACCTGGCTGCACCAGGCAGCCCTGTGGCTGGAAGCAGTGAGCTG
TGTGTTGAGCAGGGCTTTCTCTTTCTTGTGGCCTANATGCATCACTGTAAGCGATACCGTTCCCCAGAGCCAGACCCATA
CCTGAGCTACCGCTGGAAGAGGAGGCGGTCTTACAGTCGGGAGCATGAAGGTCC
Sequence Type genomic DNA
Unitrap ID UNI31779

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57609578..57609790 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032316 (Clk3) NM_007713 CDC-like kinase 3 Gene [Source:MGI Symbol;Acc:MGI:1098670]


Sequence tag IST14678D2BBF1
Sequence
GGGGTAGCCCCTCCNAGGGGTTTATGAAGTAAAGAAGAACTCTGATGTCACAGTGACAGAACAGCAGACAATGGGTGGAT
GACTCCCTCCTCTGCCAAGTGAATAAACAAACAGGTGCCTCTCCAGCCTGGCCCAGGGGCCTGANCACTCAAACNATGCA
AGCCAGGGCCCAGATACAGAAGTAGATGTAGTGNGATGCTGANCACTGCCACGGGGATGCCAAGGACAGGANGAATGNAG
AGGTTTTTTGCTCAATTTCTTCNTGCNTATGGGANCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57609787..57610060 256
 
EST/CDNA Est Name
  BY226823.1 - BY264533.1 - BY263002.1 - BY022975.1 - BY077406.1 - BY227315.1 - BY295472.1 - BF226321.1 - BY280795.1 - BY012730.1 - BY227392.1 - BY081441.1 - BY023107.1 - BY068827.1 - BY011812.1 - BY309427.1 - BY028467.1 - BY055104.1 - AW230314.1 - BY088963


Sequence tag IST14678D2HMF1
Sequence
GGGGTAGCCCCTCCCAGGGGTTTATGAAGTAAAGAAGAACTCTGATGTCACAGTGACAGAACAGCAGACAATGGGTGGAT
GACTCCCTCCTCTGCCAAGTGAATAAACAAACAGGTGCCTCTCCAGCCTGGCCCAGGGGCCTGAACACTCAAACTATGCA
AGCCAGGGCCCAGATACAGAAGTAGATGTAGTGGGATGCTGAGCACTGCCACGGGGATGCCAAGGACAGGAGGAATGGAG
AGGTTTTTTGCTCAATTTCTTCATGCCTATGGGATCCTATAACCTAAATGTTCTAGAAGCCTGGANCTAATGAACTGGTG
GCACAGANCCNAAGTACTAAACTGAAACTTGCCTGGCTAAAGCAATGAACTGGACTCAACTCNAAGAAATTCAAAACTCT
TCANTCNGTGAGGAACCACAGTANNAATGAGAACTCTGANCCTTGANCAAAGANACAATGTCTCACNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57609787..57610252 444
 
EST/CDNA Est Name
  CX244015.1 - BY735184.1 - CF732263.1 - BQ108927.1 - BF181891.1 - CB056319.1 - BY736913.1 - BE306570.1 - BI647940.1 - BG807228.1 - BI455757.1 - BI854466.1 - BQ714794.1 - BU518749.1 - BU053748.1 - BY263351.1 - CB232142.1 - BY239901.1 - CX223828.1 - BY252688

 
Come back to gene CX244015.1 - BY735184.1 - CF732263.1 - BQ108927.1 - BF181891.1 - CB056319.1 - BY736913.1 - BE306570.1 - BI647940.1 - BG807228.1 - BI455757.1 - BI854466.1 - BQ714794.1 - BU518749.1 - BU053748.1 - BY263351.1 - CB232142.1 - BY239901.1 - CX223828.1 - BY252688


For any suggestions or comments, please send an email to unitrap@crg.es