Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G073H09
Clone ID G073H09
Vector U3CEO
Project ggtc

Sequence tag G073H09
Sequence
TAAAGACTTAGNNTCTTGATCATGNNNAGGGGCATCCGTTTCCTAGGCTACAGTATCCCTGAGTGCCAGAAAATGCTGCG
TAGGGCTAAGGGTGGAGAAGAACCCCTGCCTGAGGGCTTATTTTGGCTGCTGGTAACTGGACAGATGCCCACAGAGGAAA
AGGCGNNNTGGCTCTCTCAGTANNGAGGAAAAGGGCAGATCCGCCTTCTGAGGGGGTTCCCTGCAGTGACAGTTTTCCAA
CCAATCTGCACCCTATGTCTCAGCTCAGTGCAGCCATCGCAGCCCTCAACAGTGAAAGCAACTTCGCCCGGGCATAGCAG
AGGGAATGAACCGAGCTAAGTACGGGA
Sequence Type mRNA
Unitrap ID UNI11285

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127789729..127790264 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005683 (Cs) NM_026444 citrate synthase Gene [Source:MGI Symbol;Acc:MGI:88529]

 
Come back to gene ENSMUSG00000005683


For any suggestions or comments, please send an email to unitrap@crg.es