Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12140C11
Clone ID IST12140C11
Vector VICTR76
Project tigm

Sequence tag IST12140C11HMF1
Sequence
CTCAAATCATCTTTTTGAACCCAGGGCATCTGTGATAGTTAATATTGTCCACTTAAGAGGATCTAGAATCACCTTCNAGA
CAAGCCTCTGGGTTTGTCTGTGAN
Sequence Type genomic DNA
Unitrap ID UNI25299

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88936839..88936941 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072553 (Gm525) NM_001033266 gene model 525, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2685371]


Sequence tag IST12140C11BBF1
Sequence
CTCAAATCATCTTTTTGAACCCAGGGCATCTGTGATAGTTAATATTGTCCACTTAAGAGGATCTAGAATCACCTTCAAGA
CAAGCCTCTGGGTTTGTCTGTGAGAGTTTTAAGACTCAGCTAACTGAGGTGGGGAAAGGCACATTCTAAATGTAAGCAGC
ACCATTGAATGGACTGGTTCTANACAGCCATTAAGAAAAACAGAAAGTAATCTAATCCGGGCGTCANCTTTTATTTATTT
TTTAATCGTATATATTTTTAATTTTTTTTGAAATTATAATGTAATTGCGTTATTCCCCTCTCGCATACCTCCCCCTTNNN
CNCTNTNAACTTCATGGCCTCCTTTTCTTTNNTNCN
Sequence Type genomic DNA
Unitrap ID UNI25299

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88936839..88937188 334
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072553 (Gm525) NM_001033266 gene model 525, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2685371]

 
Come back to gene ENSMUSG00000072553


For any suggestions or comments, please send an email to unitrap@crg.es