Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G073D06
Clone ID G073D06
Vector U3CEO
Project ggtc

Sequence tag G073D06
Sequence
AGGAAGTTCATGACCTGGAGAGGAAGTATGCAGCCTTGTACCAGCCTCTATTTGACAAGAGAAGAGAATTCATCNNNGGT
GACGTGGAGCCCACAGATGCAGAGTCAGCGTGGCTCAGTGAGAATGAGGAGGAGGACAAGTTGGCTGGAGATATGAAGAA
TAAAGTAGTCATAGCTGAGAAAGAAGCAGCAACAGTGGAAGAGCTGAACCCCAAAGGCATCCCTGAGTTATGGTTCACCA
TCTTCAGAAATGTGGACATGCATAGNNAGCCGGAGCAGGAAGATGGGCAAGCGATCTTGACACGATATGCAGGAGACAAA
AGNNAAGTTTTCAGACCNNNGTCAACATA
Sequence Type mRNA
Unitrap ID UNI11286

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 150718216..150721861 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059119 (Nap1l4) NM_008672 nucleosome assembly protein 1-like 4 Gene [Source:MGI Symbol;Acc:MGI:1316687]

 
Come back to gene ENSMUSG00000059119


For any suggestions or comments, please send an email to unitrap@crg.es