Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12378E7
Clone ID IST12378E7
Vector VICTR76
Project tigm

Sequence tag IST12378E7BBF1
Sequence
CTATTGCTGTGATGAAACAAATATGACTAAAGAAACTTGGAGCCGGGCGTGGTGGCGCACGCCTTTAATCCCAGCACTCC
GGAGGCAGAGGCAGGCGGATTTCTGAGTTCAAGGCCAGCCTGGTCTACAAAGTGAGCTCCAGGACAGCCAGGGCTATACA
GAGAAACCCTGTCTCGAAAAACCAAAAAAAAAAAAAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI31784

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 41021181..41021384 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038417 (Fig4) NM_133999 FIG4 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2143585]

 
Come back to gene ENSMUSG00000038417


For any suggestions or comments, please send an email to unitrap@crg.es