Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11752B7
Clone ID IST11752B7
Vector VICTR76
Project tigm

Sequence tag IST11752B7BBF1
Sequence
GTAAAGACTGGGTCTCATTTTGTAGGTCTAGCTGGCCTTGAATTTGATATGTAGAGGAGACTGGCCTTGATTTCAGAGAG
ATCTG
Sequence Type genomic DNA
Unitrap ID UNI19579

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 53146317..53146400 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018239 (Zcchc10) NM_026479 zinc finger, CCHC domain containing 10 Gene [Source:MGI (curated);Acc:Zcchc10-001]

 
Come back to gene ENSMUSG00000018239


For any suggestions or comments, please send an email to unitrap@crg.es