Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11067E1
Clone ID IST11067E1
Vector VICTR76
Project tigm

Sequence tag IST11067E1BBF1
Sequence
CTCCTAACACTGTTACTGCTTTCTTTGCCTGTTGGCTTAAGGGCATCAGAAGCCCAAAGAGGCCATGGGAAAGTCTGAGC
TTCCACTTCANTGTAATGTTTGTTGTGGCTCCTGGCANGANCACTTGCCCCTCTGGAACCAAAACTTCTAGGGCAGCAGA
ACCTAAGGTCTTGANAACAAGAAGCAAGAATTTTCCTAGTGGTTCCTAGGGGCGATAGTGTGTGAAACTATTTCCTCTTT
TGCTCCTTGATTCCTGGATCT

Sequence Type genomic DNA
Unitrap ID UNI16292

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 54044889..54045148 252
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004633 (Chn2) NM_023543 chimerin (chimaerin) 2 Gene [Source:MGI (curated);Acc:Chn2-001]


Sequence tag IST11067E1HMF2
Sequence
GGTTAGGTATTCCTTGAATGTGTACCTAGTGAAAGTGTTTATACCTCGGTTGTACAGACTAGTTTAGCTAACATGCCCCC
CAAAAAAATGTGCAAAGTCAGTAACTGTTGAAAATGTTGCAAGACATTCCACAACGAACAAATTTAAATCAGTTTATCTT
TTTCTGGAAGACGACTTGAAATCTGACCAGGGCTATTAATGTTCAGTACCACAAACAATAACACAGGGAAAAAAAAAAAA
AAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 21380102..21380343 242
NO GENE  

 
Come back to gene ENSMUSG00000004633


For any suggestions or comments, please send an email to unitrap@crg.es