Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CD0231
Clone ID CD0231
Vector pGT0lxfT2
Project sanger

Sequence tag CD0231
Sequence
AAAGTACAAATTTGCCTGACCAGGAAGAAACCTGCCAAATTCACAAATGGTGAATATTAGAGATTTGTCAGACAATGTAC
TGTATCAGACTAGAGACTACCATTTGACACCACGGACCTCATTGCATACAGCATCTAGTACTATGTACAGTAATACTAAT
CCATCACGGAGTAATTTTTCTCCACATTTTGTATCATCAAACCAACTGAGGTTATCACAAAACCAAAACAATTTTCACAC
TCGGGGAACGTTTACGTTCTTTGGTTTTTCTGGTTGTTTGAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACT
CACTTTGTAGACCAGGCTGGCCTCAAACTCAGAAATCCGCCTGCCTGTGCCTCCCGCTTGATTTGGTTTTCTCCTGCCCT
CTCCGCGACCCCTGTCCTTCCCCATATCTCTCCTGTGCTACACCCTTTTTTCTCGCTTATATACTGAGTAATGTCTGGCT
TCCCGACAATATTATCCCTTGTACCACTGTCCTTCTCCTTGTCTGCCCATTTCC
Sequence Type mRNA
Unitrap ID UNI1487

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 108773248..108773481 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034551 (Hdx) NM_001080549 highly divergent homeobox Gene [Source:MGI (curated);Acc:Hdx-002]

 
Come back to gene ENSMUSG00000034551


For any suggestions or comments, please send an email to unitrap@crg.es