Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14451D2
Clone ID IST14451D2
Vector VICTR74
Project tigm

Sequence tag IST14451D2HMR1
Sequence
TTTGTTTTGTTTATAATAAACTAAACTTGTTTGCTTTGATCNACATGAAAACCAGTACTTCTTTTAGTAGAAGCTGGAGT
CTTTAGATAAGATTTTTTTAAATTGCTATTCTATGTGGAGATTTTTGTGGTGACAGACTGAGACCCAACAGTGCTATCTA
GATTCTTGAAAACAGTGAGATTTCAAGTCAAGTCCCTTATGACATGAAAGAATGCGAGGAATGCNAGGAATCANGGAANT
ANGCNACGGTTTAAAGTATTACNCTGGCN
Sequence Type genomic DNA
Unitrap ID UNI1668

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6063920..6064187 254
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038587 (Akap12) NM_031185 A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]


Sequence tag IST14451D2HMF1
Sequence
CAAAAGGCTTACTTAAGACTTACTTGAATTTCTTTCAAGGAAATTTTAGCCCTTGAGGCTTTGCAATCAAGAGTATGTGT
GTATAAAACTCAACCAACCTGGGTTTTGTTTCCATTACAGCCCAGTATTCTCTGCCTCACTTTTATTTACCATTTTGTGC
CAAGACTGGGAGAAACTGTGATAATAAGGAAGGATTTGACAACNTTTATAACATTCCCNACCGTGTGANTGACTTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6064184..6064419 230
NO GENE  


Sequence tag IST14451D2BBF1
Sequence
CAAAAGGCTTACTTAAGACTTACTTGAATTTCTTTCAAGGAAATTTTAGCCCTTGAGGCTTTGCAATCAAGAGTATGTGT
GTATAAAACTCAACCAACCTGGGTTTTGTTTCCATTACAGCCCAGTATTCTCTGCCTCACTTTTATTTACCATTTTGTGC
CAAGACTGGGAGAAACTGTGATAATAAGGAAGGATTTGACAACATTTATAACATTCCCTACCGTGTGAGTGACTTATTTT
ATACAAAACAGAGCAGAGAGATTTCGAATTTCCATTTAAATGTCCNCAGTTACNATACNNAAGTTGGAGCTCAACTCTAA
NNACTGATTTGCNTGNNNANGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6064184..6064518 321
 
EST/CDNA Est Name
  CD540754.1

 
Come back to gene CD540754.1


For any suggestions or comments, please send an email to unitrap@crg.es