Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10918D1
Clone ID IST10918D1
Vector VICTR76
Project tigm

Sequence tag IST10918D1HMR1
Sequence
TTACAGACAGCTTGGNCCCCCCTGTGGGTGCTGGGAATTAAGCCTCTGTCCTCTANAAAAGCCAAGCGCTCTTAACTTCT
GAGCCATCTCACAGCCCCAGTGACCTGTTGATAAAAGATGCCTTGATTATTCAGTANTAGATAAATCAAAAAATAACATG
TAAAGGTGCCTGGGTAATTCTCTAACTANTATTTTTGTTTTTCATTTGAGCCTCAGAAGCTTTGGGGTCTGCANCGCTCC
CCTCCCACTCCTCTGCAATTTCACAGCATTCTAAAGGAAGTACNTCCCCCGATTTACTGATGCACCAGGGGCCACCANAC
ACTGCANAAATTATAAAATCATTACCTCAGAAATACAGAAGGAAACCTATGTCTCAAGAGGAAATGGAATTTATCCNGGT
ACGCTGTTGTTCN
Sequence Type genomic DNA
Unitrap ID UNI31794

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101508955..101509366 394
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061474 (Mrps36) NM_025369 mitochondrial ribosomal protein S36 Gene [Source:MGI (curated);Acc:Mrps36-001]


Sequence tag IST10918D1HMF1
Sequence
AGAGCAGCTGTGAATACCTACCGGAGACCCTCATATGACCAAGCTAGTAGTTAGTCAACG

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 26772423..26772481 57
NO GENE  

 
Come back to gene ENSMUSG00000061474


For any suggestions or comments, please send an email to unitrap@crg.es