Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13176F11
Clone ID IST13176F11
Vector VICTR74
Project tigm

Sequence tag IST13176F11HMF1
Sequence
AAAACTACTTGAGTTAGTACAGCTGCCGGGCAAACTGAGCCCTCATTGGCCAGC
Sequence Type genomic DNA
Unitrap ID UNI31798

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 59813673..59813725 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020101 (4632428N05Rik) NM_028732 RIKEN cDNA 4632428N05 gene Gene [Source:MGI Symbol;Acc:MGI:1921298]


Sequence tag IST13176F11BBF1
Sequence
AAAACTACTTGAGTTAGTACAGCTGCCGGGCAAACTGAGCCCTCATTGGNNNNGTCAGCTGTCCATCTGTGGGAGGGAGG
CGGAGCCAGTCTCTGGTTACCTCTAGTTTCTGGAGAAAGCAACAGGCCTGGGTTTACATTTTGTCCACAGACTTATTCTC
TGTGANACTATAGACAGCTGCCTTTTGTGATTTGGTGCCCTAACCCAAACACCTATTTCACGAGCATAGGAATTAATTAA
ATAAACAAGCCCGTGTGTGTGTGTGTGTGTGTGTGTGTGTNTNTGC
Sequence Type genomic DNA
Unitrap ID UNI31798

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 59813673..59813957 271
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020101 (4632428N05Rik) NM_028732 RIKEN cDNA 4632428N05 gene Gene [Source:MGI Symbol;Acc:MGI:1921298]

 
Come back to gene ENSMUSG00000020101


For any suggestions or comments, please send an email to unitrap@crg.es