Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11647D11
Clone ID IST11647D11
Vector VICTR76
Project tigm

Sequence tag IST11647D11HMF1
Sequence
TGTTAAGTGAACGGACAAGTCAGAGCTTCCTAAGCTTTCTCCTCACCTCCTACCATTGCACATGGACATAGCGTTTANGG
CTGAGAGAGAGAGAGAGAGANAAAAATCTGTGGACNACANACTGGATTAAAGCAATANCCCTTCCCTGAATTAAAGCANT
CCCATTAAANCTTTGTTTCTCTTTTTTTCATTAATGAANATAATTGAAACANACTTAAGTTAAAGTGTGTGTGTGAGTGT
GTGTGTGTGAGTGTGTGTGTGTGTGTGTGTGTGTGTGTGN
Sequence Type genomic DNA
Unitrap ID UNI31799

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 100519512..100519790 261
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031326 (Cdx4) NM_007674 caudal type homeo box 4 Gene [Source:MGI (curated);Acc:Cdx4-001]

 
Come back to gene ENSMUSG00000031326


For any suggestions or comments, please send an email to unitrap@crg.es