Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12093G9
Clone ID IST12093G9
Vector VICTR76
Project tigm

Sequence tag IST12093G9BBF1
Sequence
ATCTGACGCCCTCTTCTGGAGTGTCTGAAGACAGCTACAGTGTACTTACATATAATAAATAAATAAATCTTTA
Sequence Type genomic DNA
Unitrap ID UNI12847 UNI30978 UNI31801

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 9730960..9731032 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6726983..6727055 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3886574..3886646 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049721 (Gal3st1) NM_016922 galactose-3-O-sulfotransferase 1 Gene [Source:MGI (curated);Acc:Gal3st1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 8493146..8493218 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 25694343..25694415 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8661542..8661614 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025278 (Flnb) NP_598841 filamin, beta Gene [Source:MGI Symbol;Acc:MGI:2446089]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 6568911..6568983 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022148 (Fyb) NM_011815 FYN binding protein Gene [Source:MGI Symbol;Acc:MGI:1346327]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13767306..13767378 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15653178..15653250 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 6741603..6741675 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3742297..3742369 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 28884518..28884590 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 15878564..15878636 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 3211819..3211891 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3147146..3147218 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 14342638..14342710 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3024120..3024192 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3020539..3020611 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21433625..21433697 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 5755481..5755553 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 575921..575993 73
NO GENE  

 
Come back to gene ENSMUSG00000022148


For any suggestions or comments, please send an email to unitrap@crg.es