Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12034F3
Clone ID IST12034F3
Vector VICTR76
Project tigm

Sequence tag IST12034F3BBF1
Sequence
TTACTAATATGCTTCTGCAGCGTTCTGTGGAGAAAACCTGTTTTTCCCTTTTCTAATAAGGTAGCTGTTTTAGGATTAAT
CTATAAGCCAATAAGTAGATCCCTTTAAGATACTATAAAGCATTTATTAAACTCTTTGACATTAAAATATTAGATTTTGA
AAATAAAGGTAAGACTTTAATAGTGTGCATGGGAATGCACTAAATAGCATGCACGGGGATACAATTTCTCTCTTTTTTGT
CTTTTAAGAAGTTAAAGTTTTAAAATTTTACAATACCTAAACTTTTGAATNNNTAACTANTTGACAAAACATTTTAAATA
CTTGGCTGTAAAGGGGCANTGACTAATTGCACTTTTAATCNATTTTCTTANGGAGCANTTGTAACTAGAAGGCNNGCAAA
GTTATTAANANTCNCATGTGCATAATTTATTTATTAACTANANNTANGCNTAAN
Sequence Type genomic DNA
Unitrap ID UNI31094

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 136299333..136299785 417
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 9873035..9873487 417
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 69661883..69662335 417
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 89635079..89635531 417
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060961 (Slc4a4) NP_001129732 solute carrier family 4 (anion exchanger), member 4 Gene [Source:MGI Symbol;Acc:MGI:1927555]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 133961608..133962060 417
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 27140679..27141131 417
NO GENE  

 
Come back to gene ENSMUSG00000060961


For any suggestions or comments, please send an email to unitrap@crg.es