Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14729E5
Clone ID IST14729E5
Vector VICTR76
Project tigm

Sequence tag IST14729E5HMR1
Sequence
GTTNAACATCTTCCCTGTGGAGATCTGTTAGACCTAGGCAGAGGATGCTCAGGGCTCAGGCCCAGAGAACGTTC
Sequence Type genomic DNA
Unitrap ID UNI16383

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152619495..152619567 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007659 (Bcl2l1) NM_009743 BCL2-like 1 Gene [Source:MGI (curated);Acc:Bcl2l1-001]


Sequence tag IST14729E5BBF2
Sequence
GTACTTGGGTGACAGATACAGGGAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14729E5HMF1
Sequence
GAACCAAGATTGTGCATGGGCTTTAAGATAACTAGNNGNNGGGCTGGAGAGATGGCTCAGTGGTTAAGAGCACTGACTGT
TCTTCCAGAGGTCCTGAGTTCAAGTCCCAGCAACCACATGGTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152619564..152619686 115
NO GENE  

 
Come back to gene ENSMUSG00000007659


For any suggestions or comments, please send an email to unitrap@crg.es