Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12709B4
Clone ID IST12709B4
Vector VICTR76
Project tigm

Sequence tag IST12709B4HMF1
Sequence
GTGTTACTGGCGGTGGCTTTGAGGTTTCAAAAGCCCAC
Sequence Type genomic DNA
Unitrap ID UNI31544

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95761980..95762017 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013418 (B4galnt2) NM_008081 beta-1,4-N-acetyl-galactosaminyl transferase 2 Gene [Source:MGI (curated);Acc:B4galnt2-001]

 
Come back to gene ENSMUSG00000013418


For any suggestions or comments, please send an email to unitrap@crg.es