Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10123D7
Clone ID IST10123D7
Vector VICTR76
Project tigm

Sequence tag IST10123D7HMF1
Sequence
CCTTTTCTCTTTCTTTGGCAGGTGGAAGACAATGAAATTCATTGTTA
Sequence Type genomic DNA
Unitrap ID UNI31816

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7822203..7822248 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031171 (Ftsj1) NM_133991 FtsJ homolog 1 (E. coli) Gene [Source:MGI (curated);Acc:Ftsj1-001]

 
Come back to gene ENSMUSG00000031171


For any suggestions or comments, please send an email to unitrap@crg.es