Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14884H2
Clone ID IST14884H2
Vector VICTR76
Project tigm

Sequence tag IST14884H2HMF1
Sequence
TTATAATAAACTAGGAAAATATTTAAGTCATGGATCATGTGAGTAAAAGCCTTCCTG
Sequence Type genomic DNA
Unitrap ID UNI19251

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 41455271..41455324 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022307 (Oxr1) NM_130885 oxidation resistance 1 Gene [Source:MGI Symbol;Acc:MGI:2179326]


Sequence tag IST14884H2HMR1
Sequence
NTNNNTCTATACCNNATGAGATAAACAAATCACCTGAAAAGGACAATAGCAATAACATTAAAAAAACAAAAAAACAAAGA
TCATTATAGCCNCAGCAATCAATGCCTTTTCAAAAGCCTAAAGAAAGTAAAACCTATTTACGTGATATCTTTATAAAAAG
TAAAAGAAAAGAAACTCAGAAAATAAAATAACTGGAATAGCTTGGATTTCTGAAGCANCATANTTAGAGGGAGCATGGGA
GGAGCAAGTGATGTGAGTTGGGTCTGTGTGGCGAGAGTGNTGTNNNAGTCNGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 41454980..41455267 268
NO GENE  

 
Come back to gene ENSMUSG00000022307


For any suggestions or comments, please send an email to unitrap@crg.es