Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14731C5
Clone ID IST14731C5
Vector VICTR76
Project tigm

Sequence tag IST14731C5HMR1
Sequence
TGTNNNANTNNNNNNGNGNNNNGCNNNNNNTGGCNGNNNNGNNNNTGNGGNNGGCAAGGATAGTAGGTGTGGATCATAAA
TTGAGTAGATATTATCTACTCAGTTCTTCAGTCTTTCATGTGCTTAAGATACAGGCCTGTTAATGTTATACAAAGATTGT
GTGCTACAAATGCCAACAGAATCGACTTGAAATGGAAGTTCTAAATAGACATACTGTGAGTAAGTGGAATAATTATGATA
CTTAATATCTGCATAGAAAAAACAAAGTAAATTGAGCTGCTATTGTAGTTTTCATTATAGACAATTTTAATGTATACAGT
ATTATATGAGATAAGACATTCTCATCATCCAGCTTTAAAAGTGACCAGATTATTCGGTTTCAATTCCTATCCACTTCTTT
GTTTTGATATGACTGGATACAGAGTCTTGAATCACAAGTAATCTATAAATGTATTAATATCTGTCTTTGAAAGATAANTT
TTAGCTGGGCAGTGGTGGCGCACGCCTTTAATCCCAGCACTTGNGN
Sequence Type genomic DNA
Unitrap ID UNI31821

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 97082062..97082532 469
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062797 (l7Rn6) NM_026304 lethal, Chr 7, Rinchik 6 Gene [Source:MGI (curated);Acc:l7Rn6-001]


Sequence tag IST14731C5HMF1
Sequence
GACTTATCCCTTCATGTAGAAATTGTACCCACTCCTAGGAGAGAATGCCAACAGGCCTCGTAGGCCCGACCAACTCTTCC
CAAGAACAACACTACATCTCCTCCAGGACCCCACCACCCAGCGCTCATGACTCCTTCCTCTCTCCCCGGCTCCTCCTCTC
CACACTCACAGCTACTTCCCACTCTTTCTCTTTAGCAGGCTGAAGTGTCTGAGTCTTCTTTGTACTGTCGTTTGTGTGTA
TGAACCAGGGATCACACTCATGCTGTCAGGCTTGCAGGGTAAGTGTTTTTACTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 97082580..97082874 295
 
EST/CDNA Est Name
  AI037128.1 - AA982782.1 - AI157568.1 - AA623430.1 - AA221982.1 - BE627635.1 - BF012911.1 - CJ171683.1 - CA459572.1 - CJ185314.1 - CJ184352.1 - AA881096.1 - W18355.1 - AA968289.1 - AI785957.1 - CA567926.1 - AI529699.1 - AW986719.1 - AA986231.1 - AI530087.1

 
Come back to gene AI037128.1 - AA982782.1 - AI157568.1 - AA623430.1 - AA221982.1 - BE627635.1 - BF012911.1 - CJ171683.1 - CA459572.1 - CJ185314.1 - CJ184352.1 - AA881096.1 - W18355.1 - AA968289.1 - AI785957.1 - CA567926.1 - AI529699.1 - AW986719.1 - AA986231.1 - AI530087.1


For any suggestions or comments, please send an email to unitrap@crg.es