Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14650B9
Clone ID IST14650B9
Vector VICTR74
Project tigm

Sequence tag IST14650B9HMR1
Sequence
CTTTGCATGGTCTCATGTAGCTTGGGCTGGCTTTCGTCAAGGATGACTTTGAAATATTGATCTGCCAGCTTCCAATTTGA
ATTCCTAGTCCTCTAGCCACCGCCTATGTGCTAGGATTGTAAGGCATGANCCAAACTTAATAACTTTTTAAAAAATATTT
TTTATTCNTATGTGTGTGGTCTGTC
Sequence Type genomic DNA
Unitrap ID UNI29452

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 35172208..35172391 178
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066568 (Lsm14a) NM_025948 LSM14 homolog A (SCD6, S. cerevisiae) Gene [Source:MGI (curated);Acc:Lsm14a-001]


Sequence tag IST14650B9BBF1
Sequence
NAATAATCCCCAAACCTCTACAAAAACACTTCAGCNAGAAATACTGTTCTCAACCAGTGTGTAGAACACCTGGTGAGAGC
TTTACCCACCCTTTAATAAAGTCATTAAAACTAACACCATCAAGCTGTTTAAGGACATCACAGTCAACTCTCATTTGTTT
TTGAGGCAGTGTCTCACTCGGAAGTTTTGGAACTCTCTAAATTGATGAGGGTTGCTTGGAACTNNNATCCNCCTGGCACT
AATCTCCTGAACGCCGGCACCAAGGCCCGTACCACCAAGCCCANCTTCACACTATTAGTCAAGGCTTCAGTAATTACTAA
GGAGAATCATACATCCTTAAGTATAGTGAACATCTACAAAGATNAAAGCNNGTTCTTTAANAGNCNNTGTGTTACAAAAC
TCCATANNGCNAANANAAAGTTATGGGGNANTTCCTGGANTCTCNNTNTTGGCCTTCNNTGANANGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14650B9HMF1
Sequence
GAATAATCCCCAAACCTCTACAAAAACACTTCAGCGAGAAATACTGTTCTCAACCAGTGTGTAGAACACCTGGTGAGAGC
TTTACCCACCCTTTAATAAAGTCATTAAAACTAACACCATCAAGCTGTTTAAGGACATCACAGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 35172391..35172535 145
 
EST/CDNA Est Name
  AA637621.1

 
Come back to gene AA637621.1


For any suggestions or comments, please send an email to unitrap@crg.es