Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14803F7
Clone ID IST14803F7
Vector VICTR76
Project tigm

Sequence tag IST14803F7HMR1
Sequence
GGGTNAGGCAAAAAGGTGGATGCAATTGGTAAAAGGGCAGCTTTCGGAGCTGCAATGGGTCC
Sequence Type genomic DNA
Unitrap ID UNI31827

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 7000889..7000949 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024957 (Kcnk4) NM_008431 potassium channel, subfamily K, member 4 Gene [Source:MGI Symbol;Acc:MGI:1298234]


Sequence tag IST14803F7HMF1
Sequence
ACCCTTGAACCTCAGCCTGTGGATGATCCCAGAGCCACACTGTCCCTTCCTGCATTGGCCCAAAAGCACTCCCTTCTCTA
GGAACCTTTCTTGAAAGCCTCGGGTTTGTTTCAACCTTCACTGCCTCTCTGTATTTGGCTAGCAAAATGCAGATAAATTA
CAAAACCAGGACGACTCATGCAATATTTGGGACATAGCTTAAAATCGTATTCGTTGTTCATCTGAAATTCACATATAACT
GGCCTTTCTAGTTCTGTTGTTTTTGAAACAGAGTCTCATTCTATAACCCAGGCAAGTCTAAACTCGCAGCAATCCTCCTG
ATTCTGCTCTGCTTACAAAGTGCTGGGATTTACAGACATGTACTACCTACCACCTTGCCTCTCTGAGTTCTTATTTGCTA
ACCCTGACAGCCCTATCTATCCACGAANAACGANGTGGTTGAGTCTCTGACAAACCTGAATTTACTCCNNNGTTCCCGTT
AGCGCACCGTCCGGGTCTNAATGTCAGANAANCCCACATTTTGGANGGGNNCCNGANTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 7000946..7001484 513
 
EST/CDNA Est Name
  BB569111.2


Sequence tag IST14803F7BBF1
Sequence
ACCCTTGAACCTCAGCCTGTGGATGATCCCAGAGCCACACTGTCCCTTCCTGCATTGGCCCAAAAGCACTCCCTTCTCTA
GGAACCTTTCTTGAAAGCCTCGGGTTTGTTTCAACCTTCACTGCCTCTCTGTATTTGGCTAGCAAAATGCAGATAAATTA
CAAAACCAGGACGACTCATGCAATATTTGGGACATAGCTTAAAATCGTATTCGTTGTTCATCTGAAATTCACATATAACT
GGCCTTTCTAGTTCTGTTGTTTTTGAAACAGAGTCTCATTCTATAACCCAGGCAAGTCTAAACTCGCAGCAATCCTCCTG
ATTCTGCTCTGCTTACAAAGTGCTGGGATTTACAGACATGTACTACCTACCACCTTGCCTCTCTGAGTTCTTATTTGCTA
ACCCTGACANCNNNATCTATCCNCGAANAACGAGGTGGTTGAGTCTCTGACANNCCTGAATTTACTCCNANGTTCCCGTT
NNCGCANCGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 7000946..7001435 464
 
EST/CDNA Est Name
  BB569111.2

 
Come back to gene BB569111.2


For any suggestions or comments, please send an email to unitrap@crg.es