Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14660H6
Clone ID IST14660H6
Vector VICTR74
Project tigm

Sequence tag IST14660H6HMR1
Sequence
ANGGTCTGGGGGTGATTGGACAGGCCCTGGCCTTCGCCGTCNCCCCCCACCTTCCTCCCGCCCCTCTCTCCTAAGAGGGC
GCCACCTGCATGCTCTGATGGGCACCAGCCGGGGCCAGTGGGGGAGCCTGTTGCCATGGCAGCGCAGGAGGTTGGGCCCA
CGTTCCCATGGCCNNCT
Sequence Type genomic DNA
Unitrap ID UNI10567

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 87331906..87332076 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030539 (Sema4b) NM_013659 sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B Gene [Source:MGI (curated);Acc:Sema4b-001]


Sequence tag IST14660H6HMF1
Sequence
NCTGGTTCCNNNCTCNTTCNGTCCCCTACCTGGAAGGANTTACNTCCCACNATAGGACTACCTCCGCGCGGCCCCNAANT
CCNGNAAGTCCNACTGGANTCCNANTGGCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000030539


For any suggestions or comments, please send an email to unitrap@crg.es