Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14811C5
Clone ID IST14811C5
Vector VICTR76
Project tigm

Sequence tag IST14811C5HMR1
Sequence
NTNCCCTTGGTTTTCCNTAANTGAANTTTCTCTCCTGGCTCGTGGCTCTGCTCCGTTGTCTGTGTCTGGCTGTTGCCAGC
ATCACACTGTGTGATGGCTGCTGTATGGCTTTGTAGTAATTCTGAAACTGAAATATGAAGCCNGCTTTCCTCAAACTGCT
TGTTTTGCTTTGGATCCCTTGCATTTCTCTGTGGTTTTAGAATCTGCTTGTCTGTTTCTGTGAAAGAGGTATTTGAAATT
TTTATAGGTATTACAGTGACTTGTTCTTTACTGAGGANGTATTCTTGCATANGTAAAAAAAAAAANAC
Sequence Type genomic DNA
Unitrap ID UNI31830

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 105385476..105385777 290
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032570 (Atp2c1) NM_175025 ATPase, Ca++-sequestering Gene [Source:MGI Symbol;Acc:MGI:1889008]


Sequence tag IST14811C5HMF1
Sequence
CAGCGAAGACAGTCTCCTAAATGGATGGCACTGGATAGTAGCATTCCCTGCAAAACAATACAGCTGGATTTTATCTCAAA
ATTGAGCAAGTGGAAAAGCTAAACTAAAATGCCTAGAATAAAACATAAATCAGTTTAATCATCCTGGTCAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 105385791..105385942 152
NO GENE  


Sequence tag IST14811C5BBF1
Sequence
CAGCGAAGACAGTCTCCTAAATGGATGGCACTGGATAGTAGCATTCCCTGCAAAACAATACAGCTGGATTTTATCTCAAA
ATTGAGCAAGTGGAAAAGCTAAACTAAAATGCCTANAATAAAACATAAATCAGTTTAATCNTCCTGGTCAACAATCAAAG
CNAATGAAACCATANGTTTTCAAAAAGTCCAANGAANANGGAAAATACTTGAAANCCTTATTTCTGANANNNGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 105385791..105386017 211
NO GENE  

 
Come back to gene ENSMUSG00000032570


For any suggestions or comments, please send an email to unitrap@crg.es