Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G068A08
Clone ID G068A08
Vector U3CEO
Project ggtc

Sequence tag G068A08
Sequence
AAGCACCACCTCCCTGAGTGTCACCTGGAGCATCCCGGTGTCACAGCAGAACCGTGTGTCAAGTACGAAGTCACCTACCG
CAAGAA
Sequence Type mRNA
Unitrap ID UNI10129

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 140874425..140874511 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006445 (Epha2) NM_010139 Eph receptor A2 Gene [Source:MGI (curated);Acc:Epha2-001]

 
Come back to gene ENSMUSG00000006445


For any suggestions or comments, please send an email to unitrap@crg.es