Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14294C1
Clone ID IST14294C1
Vector VICTR74
Project tigm

Sequence tag IST14294C1BBF1
Sequence
CCTCCACGGCCTTTGTGGTGCACATCAGGCAAACTCACACTTTGCTGCCATACCTTTCTCTCTGGAACCCAGAAGAGCAG
CCGTGTGAGAGAAAACACAACACAAACTCAGTTCAGAGACAATGGTGACTCAATCTCTGGGCGCAACAACTAAAACTTAA
TCCTGTAAACCTTACTAAAATCTGATTCCTCCAGTGGTGAATCCTTGCAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI20076

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96040123..96040337 215
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041440 (Gk5) NP_796326 glycerol kinase 5 (putative) Gene [Source:MGI (curated);Acc:Gk5-001]


Sequence tag IST14294C1HMF2
Sequence
GTATAAGGCTGGGGCATGACTGCGAGTGAACGTCTGAGGCTCCCCTCCCCCCAGGCCGCTNGNNNCCTCCATGACCCCCT
GGCGGGAGCGGCTCTGTGTCTCCTCCCTGTCGCCATGGCAGGGATATGACCGCGATTAACTGTGAGGCAGGGGAATGAAG
TGAAGTGACTGAGGCAGGGGGATGACTGTGATTGAATTTCTGAGGCNNGGGGATGACAGTGAGTGATTTTCTGAGGCAGG
GGGATGACTGTGAGTGACTGTGTGAGGCANGTGGATGGCACTGATTGTNTGTGTNNNNNNNNGCTATGACTATGANTGAN
TTTNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000041440


For any suggestions or comments, please send an email to unitrap@crg.es