Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14963F1
Clone ID IST14963F1
Vector VICTR76
Project tigm

Sequence tag IST14963F1BBF1
Sequence
CTATGTACCCGAGAGTTATTTGTCGTCTTTGGGCGATGTGATGGGATTTGGACCTCTGCACACCGAGGACAGTTTGGGGA
AGAATCCAGAACTTCCTGGGGTGATAGGGACCCAGAGAAAACAGGTTTCTGACTGAAGCCTGGTGGGGGANGGGCNCTCN
Sequence Type genomic DNA
Unitrap ID UNI16360

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28259420..28259578 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055200 (Sertad3) NM_133210 SERTA domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2180697]

 
Come back to gene ENSMUSG00000055200


For any suggestions or comments, please send an email to unitrap@crg.es