Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12896C7
Clone ID IST12896C7
Vector VICTR76
Project tigm

Sequence tag IST12896C7BBF1
Sequence
CTACAAAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCT
Sequence Type genomic DNA
Unitrap ID UNI13754 UNI16080 UNI17632 UNI29694 UNI31834

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 4821440..4821491 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 27886291..27886342 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 37189656..37189707 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022286 (Grhl2) NM_026496 grainyhead-like 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2182543]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 87951858..87951909 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 4927562..4927613 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052812 (CT571254.7) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8C3P6]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77702062..77702113 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017453 (Pipox) NM_008952 pipecolic acid oxidase Gene [Source:MGI (curated);Acc:Pipox-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 36867730..36867781 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035934 (Pknox2) NM_001029838 Pbx/knotted 1 homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:2445415]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 54981792..54981843 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000959 (Oxa1l) NM_026936 oxidase assembly 1-like Gene [Source:MGI Symbol;Acc:MGI:1916339]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 5666939..5666990 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 53522968..53523019 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 33555832..33555883 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148152060..148152111 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 29502295..29502346 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 154707035..154707086 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 81732532..81732583 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 119211009..119211060 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 11492023..11492074 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 18325567..18325618 52
NO GENE  

 
Come back to gene ENSMUSG00000000959


For any suggestions or comments, please send an email to unitrap@crg.es