Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13000E12
Clone ID IST13000E12
Vector VICTR76
Project tigm

Sequence tag IST13000E12HMR1
Sequence
NAGTATGTTTTGAGTGTGTGTCCNTGTGCCACCACACGCATGTGGAGATNANAGGACAAGTTTTAAGAATGGGCTCCAGC
CGGGCATGGTGGCACATGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCGAATTTCTGAGTTCGAGGCCAGCCTGG
TCTACAAAGC
Sequence Type genomic DNA
Unitrap ID UNI16140

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4895672..4895839 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006464 (Bbs1) NM_001033128 Bardet-Biedl syndrome 1 (human) Gene [Source:MGI Symbol;Acc:MGI:1277215]


Sequence tag IST13000E12BBF1
Sequence
CTATTTANNNTNTNTTTAAAATATATACTANNAATAAAANTGANTCCNGNNNATGGANANATGGNTNNNGANTTAANGGC
NCTGGCTACTTNANCANANGACCCTGGTTCAAATCCCCCATCCNCNTGGTGGCCCCNNATCCNGGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13000E12HMF1
Sequence
CTATTTATAGTATATTTAAAATATATACTATAAATAAAAATGAGTCCTGGAAATGGAGAGATGGATCAGGAGTTAAAGGC
ACTGGCTACTTGAGCAGAGGACCCTGGTTCAAATCCCACATCCACATGGTGGCCCCAGATCCAGGGGATCCTATGTCCTT
CTCTAGCCTCTATGGAAACGGCATATGTGGTGCATAGACGGCATATGTAGGCTAGCAGCTATACATACAAAATTAATTAA
AAAATAATCCCAATTGGTTATCCAATACCCAATANTCAGCCCTGAAATTTAATATGTACTATATGGACTGATCAGATTGT
AATAGTGTGTGTGTTTGTGTGTGTGTACTGATCAGATTGTAATAGTGTGTGTGTGTGTGTGTGTGTGTGTGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4895838..4896226 381
NO GENE  

 
Come back to gene ENSMUSG00000006464


For any suggestions or comments, please send an email to unitrap@crg.es